Promega

RVprimer3 (clockwise)

Varenummer: E4481
Kort informasjon 2 µg
  • Produktinformasjon
  • Relaterte produkter
  • Alternative produkter
  • Spesifikasjoner
The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc Vectors and pCAT3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates. Primer Sequences: RVprimer3, 5'-d(CTAGCAAAATAGGCTGTCCC)-3'; RVprimer4, 5'-d(GACGATAGTCATGCCCCGCG)-3'.|

Det finnes ingen relaterte produkter.

Det finnes ingen alternative produkter.
Ekstra spesifikasjoner
Store at -20°C. The primers are supplied dried.|

Kontaktperson(er) til dette produktet

Christine Rindal Ibra 944 34 009 christine.rindal.ibra@nmas.no
Claudia Emmanuel 951 51 950 claudia.emmanuel@nmas.no
Monica Laukas 404 40 960 monica.laukas@nmas.no

Kontakt oss

Ønsker du mer informasjon om våre produkter eller tjenester?
Fyll inn dine kontaktopplysninger og hva saken gjelder, så tar vi kontakt med deg.

Kontaktskjema
Bedrift
Telefon
E-post
Melding