The SP6 and T7 Promoter Primers are designed for sequencing inserts cloned into the pGEM Vectors. The SP6 Promoter Primer is designed for sequencing inserts cloned into the pALTER-MAX and pCI-neo Vectors. The primers are designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primers are purified by gel electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing the pALTER-MAX, pCMVTNT, pTNT and phMGFP Vectors, and the pCI/pSI series of mammalian expression vectors. Primer Sequences: (SP6) 5'-d(TATTTAGGTGACACTATAG)-3', (T7) 5'-d(TAATACGACTCACTATAGGG)-3', (T7 EEV) 5'-d(AAGGCTAGAGTACTTAATACGA)-3'.|